Saturday, April 21, 2007 RSS Logo

One more booby


another nice booby
...at Kilauea lighthouse, Kaua'i, December 22, 2006, lifer number 491.

Bush administration muzzles NPS on age of Grand Canyon

An organization called Public Employees for Environmental Responsibility charged today that the Bush Administration, apparently catering once again to Christian fundamentalists, refuses to let the National Park Service tell visitors how old the Grand Canyon is.

"In order to avoid offending religious fundamentalists, our National Park Service is under orders to suspend its belief in geology,” stated PEER Executive Director Jeff Ruch. “It is disconcerting that the official position of a national park as to the geologic age of the Grand Canyon is ‘no comment.’"
The decision follows the earlier controversial decision to allow the sale of a Young Earth Creationist book at the canyon bookstore, despite a Park Service policy
on “Interpretation and Education (Director’s Order #6) which reinforces the posture that materials on the “history of the Earth must be based on the best scientific evidence available, as found in scholarly sources that have stood the test of scientific peer review and criticism [and] Interpretive and educational programs must refrain from appearing to endorse religious beliefs explaining natural processes.”

RWP once again wonders how he could possibly have voted for the Creationist Kook from Crawford.

A nice pair of brown boobies


A nice pair of boobies
Merry Christmas from the tropical Pacific!

Kaua'i bird picture of the day

A Laysan albatross
Laysan Albatross. There were several cruising the coves next to Kilauea lighthouse this morning. Lifer number 490, BTW; 489 was a Lesser Golden Plover, last night, in the hotel parking lot. Below is a Kolea (Lesser or Pacific Golden Plover), winter plumage. The picture was taken on Kaua'i this afternoon.
Kolea

IDiocy around the clock

Sal Cordova of the Uncommon Dissent weblog is apparently trying to take the heat off Dave Scot by posting something equally IDiotic about molecular evolution. Cordova has taken a paper which notes the well-known variation in molecular clock rates, and suggests fixes, into some sort of condemnation of molecular clocks in general. Molecular clocks, like any useful tool, are valuable if used carefully and not beyond their capabilities. That's evidently too sophisticated an idea for the IDiots.

Cordova says that this vindicates Michael Denton, who wrote (according to Sal) in 1985

the idea of uniform rates of evolution [molecular clocks] is presented in the literature as if it were an empirical discovery. The hold of every evolutionary paradigm is so powerful that an idea [molecular clocks] which is more like a principle of medieval astrology than a serious twentieth-century scientific theory has become a reality for evolutionary biologists…the biological community seems content to offer explanations which are no more than apologetic tautologies.

Where to begin? First of all, the molecular clock was an empirical discovery; it was a result of the observation of the rate of change of hemoglobin sequences. Like most hypotheses, since its inception it has been discovered to be too simplistic, and has been modified, exceptions analysed, and so on. That's the way science works, and it seems to bother simple minds like Cordova's and DaveScot's. By the mid-80's, when Denton wrote his book, it was already recognized that clock rates were widely variable. These were discussed by Vawter and Brown, and by Ayala, to take just two examples from 1986. So in attacking the 'uniform rates' of evolution, Denton was attacking a straw man; by the time he wrote 'A Theory in Crisis', this was already known to be far too simplistic. Twenty years later, Cordova still hasn't gotten it.

Not one to be outdone in stupIDity, of course, DaveScot now says molecular clocks are 'exploded'. Oh yeah, just like the tree of life.

Of men, mice, coelacanths, and DaveScot

(...obviously in order of decreasing IQ)

DaveScot, whom Bill Dembski obviously keeps around because every village needs an idiot, just got all excited because he found a press release that seemed to him to indicate a molecular phylogenetic analysis of a certain ultraconserved DNA sequences, consisting of SINE elements, indicated coelacanths are more closely related to humans than tetrapods. Ol' DFave went so far as to subtitle his discovery 'The Sound of the Tree of Life Exploding'.

Alas, no.

First problem: press-releases are written by PR types, not scientists, and they don't always get the science right. Of course, if you're not well enough up on the background to understand the science, you're stuck. The actual paper is here. It's a little unfortunate that this isn't open-access, but you can always go to a library. (Hint for IDiots, that's a big building with a lot of books in it.)

Anyway, Dave did find an online presentation by David Haussler, the principal author, which contained some genetic data. (You can get much more data online as supplemental information for the paper.) In that presentation, Dave found a figure he understood, a comparison of a sequence of 85 DNA bases from the SINE element of the coelacanth with homologous sequences in various tetrapods. This is what Dave saw:

LF-SINE   GATCGAACTACCCTCTCAACCCTGTAG---AGGTGGTCCCTCCAGGGCAGGGTTGAGG
I-Human   GATCTTATTACCCTC-CATTCCTGTGA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Chimp   GATCTTATTACCCTC-CATTCCTGTGA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Dog     GATCTTATTAC--TCTCCATTCTGTGA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Mouse   GATCTTATTACCCT-TCATTCCTACCA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Rat     GATCTTATTACCCT-TCATTCCTGCCA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Opossum GATCTTATTACCTTC-CATTCTATTGA---GGGTGGTCCAGCCAGGTCAAAGTCGAGG
I-Chicken GATCTTATTACC-TCCCATTCTAGTAA---GGGTGGTCCATCCAGGTCAAAGTCGAGG
I-Frog    GATCTTATTA-CCTCTCACACTGGTGGTGAGGGTGGTCCAGGTAGGTCAAAGTCGAGG

CACATTGGCAGGGCAATGTGGGGAA-G
T-CAATAATAGGGCA------GGAA-G
T-CAATAATAGGGCA------GGAA-G
T-CAATAATAGGGCA------GGAA-G
T-CAATAATAGGGCA------GAAA-G
T-CAATAATAGGGCA------GAAA-G
T-CAATAATAGGGCA------GAAA-G
T-CAATAATAGGGCA------GAAA-G
T-CAATAATAGGGCA------GAAA-G

Dave doesn't know too much biology, but he can count. Aha, he said, there are 54 identities between humans and coelacanths, and only 45 between humans and frogs. Humans are therefore closer to coelacanths than to frogs, Evolution is wrong!

Ahem, no, that isn't how it works. Look at the sequences above, and you'll notice that there are many instances --12 in fact --, where all the tetrapods are identical to each other, and different from the coelacanth. That immediately tells you the coelacanth branched off long before any of the tetrapods. If you want to confirm this inference, you can use methods such as maximum parsimony, or maximum likelihood, both of which draw the most likely phylogenetic trees for the data. (There are more sophisticated tools too, but these are easy). You can even download programs which do these calculations for you. I had a freshman class do this a couple of years ago. I used the program dnapars from the PHYLIP package, written by Joe Felsenstein.

Here's the output tree.

  +--I-Dog     
  |  
  |        +------I-Frog    
  |        |  
  |     +--6--I-Chicken 
  |     |  |  
  |  +--5  +-I-Opossum 
  |  |  |  
  |  |  |  +I-Rat     
  1--3  +--4  
  |  |     +I-Mouse   
  |  |  
  |  |  +I-Chimp   
  |  +--2  
  |     +I-Human   
  |  
  +-----------------LF-SINE   


requires a total of     55.000

  between      and       length
  -------      ---       ------
     1      I-Dog        0.047059
     1           3       0.011765
     3           5       0.011765
     5           6       0.023529
     6      I-Frog       0.117647
     6      I-Chicken    0.047059
     6      I-Opossum    0.035294
     5           4       0.035294
     4      I-Rat        0.000000
     4      I-Mouse      0.011765
     3           2       0.011765
     2      I-Chimp      0.000000
     2      I-Human      0.000000
     1      LF-SINE      0.294118

It's what we call an unrooted tree, and that's a little confusing, but here's the bottom line: the LF-SINE element from coelacanth is 29.4% different from the node that separates it from all the other animals. The next most distant animal is the frog, then the chicken and dog, then the opossum. The only anomaly in the tree is the dog, which is more different from the other placental mammals than you might expect, but it's similar enough that it's likely to be a statistical fluke.
So i guess it's evolution 1, DaveScot 0, though it's not the first time Dave has been shafted by evolution.

Lifer number 488

A horned grebe with two coots
Yes, that's a horned grebe, winter plumage, on the Columbia river at Kennewick, in the company of two coots (actually, two of about 100,000 coots). Not the best picture, but I didn't have a telephoto with me.

Phew, what a relief!

I've been worried I'm turning into a mushy headed moonbat recently, because the Religious Right has been annoying me so much.

Apparently not.

RWP's Political Profile
Overall: 75% Conservative, 25% Liberal
Social Issues: 100% Conservative, 0% Liberal
Personal Responsibility: 75% Conservative, 25% Liberal
Fiscal Issues: 100% Conservative, 0% Liberal
Ethics: 50% Conservative, 50% Liberal
Defense and Crime: 50% Conservative, 50% Liberal

(By the way, isn't liberal ethics an oxymoron? And I'm damned if I can see how I scored so left-wing on defense and crime. )

Proscience, or just pro-Democrat?

While RWP is a devoted reader of scienceblogs.com, and values much of what he reads there, he is generally disgusted at the open partisanship of the site. Just today, Jason Rosenhouse is crowing at the resignation of the EPA administrator, who is apparently not willing to face 'oversight' from John Dingell or Henry Waxman. Rosenhouse apparently thinks this has to do with some malfeasance in office. Far more likely it has to do with Dingell's addiction to McCarthyite tactics against scientists and scientific administrators.

Case in point: in 1991, John Dingell went after David Baltimore, over a case of alleged academic fraud, in which a postdoc of Baltimre's was accused (and later cleared of) scientific fraud. Anthony Lewis, no conservative, characterized Dingell's pursuit as a 'most savage and prolonged attack', a result of Dingell's 'arrogance of power'. He called the Nobelist before his committee and berated him publicly. Baltimore subsequantly resigned as President of Rockefeller University; Dingell paid no price for his 'abusive record'. Dingell also hounded Donald Kennedy, provost of Stanford, into retiurement; Kennedy was also eventually exonerated.

Dingell's staff also invaded FDA , harassed scientists, and helped themselves to confidential business documents. No friend of science could possibly celebrate Dingell's return to power. But a partisan Democrat could.

A creationist brings his theory to school

Man with brick enters Monroe Middle School

From Monroe County, Michigan, via the Darwin Central forum

A man waving a brick barged into Monroe Middle School and ranted about the teachings of evolution before being arrested by police Tuesday morning. Middle school principal Ryan McLeod said while employees in the school's main office felt threatened by the man's bizarre behavior, he never confronted any students or entered a classroom. "The best part is, no students were in danger," Mr. McLeod said. "Fortunately for us, he came right into the office. It's pretty obvious he was kind of disturbed." Police rushed to the school at 503 Washington St. about 11:15 a.m. and took the man into custody. He was warned three times to drop the brick or be shot with a Taser. The man eventually complied and was taken away in handcuffs. No one was injured in the incident. The man was identified as Mark A. Wood, 26, of 204 W. Fifth St. He is being held in the Monroe County jail on charges of attempting to assault or resist a police officer, violating the school weapons free zone and disorderly conduct. Monroe police reported the man walked into the school office and immediately headed down a hallway toward the principals' offices. When stopped by employees, he began yelling at them asking if he looked like a monkey. They then noticed Mr. Wood was holding a brick. A teacher, an assistant principal and a secretary tried calming the man down, but he continued his rant about teaching evolution in schools and asked if the employees thought he looked like an ape. "He had a brick in his hand and started shaking it in the air," Mr. McLeod said. "The police were called immediately."

Norman Wallman in District 30

This is the first of the Right Wing Professor's endorsements for the 2006 elections, and it's one of his least enthusiastic.

Norman Wallman is a Republican turned Democrat who says he's grown disenchanted with the GOP's failure to live up to its historic principles. Music to RWP's ears. Unfortunately Wallman also supports teaching 'alternatives to evolution', i.e. religion, in public schools. So why endorse him? Well, so does Tony Ojeda, his opponent. Ojeda has in fact made a career of religious zealotry, running two years ago against Chuck Wilson on a strict 'no stem/fetal cell research' ticket. Ojeda is younger and more dangerous, and if allowed will make a political career of shoving his religious views down everybody's throat. Let's nip this one in the bud, shall we?

RWP will be holding his nose while voting for Wallman, the lesser of two evils.

Full candidate profiles are here.

Biologists easily 'annihilable'

In an article posted on 10/14, Christian Conservative FReeper stultorum posted the following genocidal sentiments.

"The evolutionists are only here to throw sh*t on the Christians... that is their sole purpose... Exactly! The enemies of Christianity know that their pseudo science is bogus, fake, phony and fraudulent. They can fool some of the people some of the time, but they can't fool the vast majority of people. The only reedeming feature about these neo anti-Christians is that there are so few of them and, hence, easily annihilable. And the battle continues as it has for 2 thousands years.

FR is a moderated forum, and management has historically quick to delete violent postings and ban the offending poster. Stultorum has been banned, but his thoughts are still up, despite being featured on the 'Fundies Say the Darndest Things' website. One can only assume, therefore, that Jim Robinson and his bible-thumping cohorts approve; in fact, such postings are now common on FR.

More bannings at FR

In another purge today, some of the few remaining pro-science posters were banned at FreeRepublic.

Ironically, several of the bannees were removed for drawing attention to the source of an anti-evolution article, which was taken from a Japanese Moonie publication. Curiously, with one exception, fundamentalist Christians at FR leapt to the defense of the cult-like Unification Church. When the smoke cleared, several long-time pro-science posters has been banned.

Why so protective of the Moonies? With donations seriously down, the FReepathon going on for ever (the much-despised NPR pledge drives are done in a week, for heaven's sake!) one wonders if, perhaps, the Reverend Moon may have decided to buy himself a conservative webforum?

Heavily implicated in the bannings is Clinton-obsessed web-kook Alamo Girl, a.k.a. Sandra Venable, a fundamentalist Christian forum moderator who has, on the FR forum, compared 'proselytizing atheists' to the Midianites, and said they deserve a similar fate. For those of you who missed Sunday School, the Midianite men and male children were exterminated on the Old Testament god's orders, and their women and girl children raped and enslaved.

Meet the beetles!

Lincoln's most distinctive and probably most interesting inhabitants just got a boost from the feds. The nearly extinct Salt Creek Tiger Beetle, a denizen of the saline wetlands on the north side of the city - the salt in those wetlands is why Lincoln exists at all - is to be the beneficiary of a $500,000 grant to preserve its habitat.

Of course, scroll down to the forum to find the usual dead-from-the-neck-up cries that the money would be better spent on the homeless or cancer research. Those aren't the alternatives, folks. The alternatives are, preserve the wetlands, or build another 1,000 cookie cutter houses near I-80 in North Lincoln. You want to spend more money on cancer research or the homeless, the American Cancer Society and People\s City Mission are always happy to accept donations.

...and FR can't handle the truth

Removed within 5 minutes.

Stalinesque purge of scientists on Free Republic

RWP used to think 'The Republican War on Science' was hyperbole. He is rapidly changing his opinion. The Deutsch affair, where the Bush administration appointed a 23-year old fundamentalist college dropout to rewrite NASA web pages to make them compliant with biblical literalism, and who attempted to muzzle a senior and distinguished NASA atmospheric scientist, was a very bad sign. The embrace of the trojan horse 'intelligent design', and even unapologetic creationism, by most conservative media, was a second. Now, it appears that Free Republic, the self-styled 'premier conservative web forum', is engaged in a full scale purge of scientists, or at least those scientists who outspokenly favor evolution.

RWP himself was banned a few months ago, for demanding that the site ban a deranged nutcase who went by the name of Agamemnon (actually an unemployed fundamentalist biochemist from Connecticut), who was posting overt libel. Agamemnon has now re-registered under the username Conservative Biochemist; he and Jim Robinson, the dictator of FR, will soon be the happy recipients of 'cease and desist' letters. But this week, the pace has accelerated:

  • one pro-evolution poster was banned for pointing out that several quotations purportedly refuting the concept of the Separation of Church and State were in fact misrepresented. One can see why this would bother Jim Robinson, since he has himself in the past posted fake Madison quotes for the same purpose
  • another poster, a physicist, was banned today for questioning the sincerity of the co-pilot in the Kentucky plane crash, who had asked for prayers.
  • still another poster, a mathematician, was banned for the trumped up reason having two accounts; something that many if not most posters have created.
Over the last three years, FR has gone from a forum where a diverse range of conservatives and libertarians, secular and religious conservatives could debate the future of the movement, to the point where questioning even the most extreme claims of the Religious Right is cause for banning. And, of course, science challenges those claims, so science must be purged. In this respect, FR has become a microcosm of the Republican Party itself, which, unable or unwilling to carry out most of the substantive parts of the conservative agenda, despite four years of bicameral majorities, and faced with multiple foreign policy disasters, including a bloody and seemingly interminable war in Iraq, has reduced itself to empty gestures and petty assaults on the Establishment Clause, to satisfy an ever contracting base of fundamentalist Christians.

Free Republic once boasted a fair quota of conservative thinkers and intellectuals, and had a measurable impact on the 2004 election, It has become a cultural zoo of the worst sterotypes of conservatism: proudly ignorant, woefully illiterate, violently abusive biblical literalists. To everything there is a season, and the summer of Free Republic has turned to late fall. Requiescat in pace.

Foiled by those darned election laws!

So former cosmetologist Kate Witek announced yesterday she was switching parties (raising the average IQ in both the GOP and the Dems). Today, the ever more pathetic Democratic Party nominated her as their candidate for State Auditor.

It's just too bad the filing deadline for incumbents has long since passed. But election laws don't apply to Democrats, do they?

Put down the hookah, Dr. Tomlin

One hesitates to speculate what the commentary editor of Nature was smoking when she penned her latest editorial 'Revival in Iran'. In the midst of a paean to Iran's recent embrace of scientific research (I wonder why they're suddenly interested in the physics of gas centrifugation and nuclear reactions, eh?) she spewed out the following dreck:

One practical advantage for science in Muslim countries is the lack of direct interference of religious doctrine, such as exists in many Christian countries. There has never, for example, been a debate about darwinian evolution, and human embryonic stem-cell research is constrained by humanistic rather than religious ethics.
This will be news to the hard-pressed Turkish biological science community, who have been professionally and sometimes physically attacked by Islamists for teaching evolution. It will be news to the authors of this and this and this.

How can the commentary editor of a reputable journal be so abysmally ignorant?

ID the yam?

Paul Nelson, indefatigable searcher for evidence of intelligent design, notes (as reported by pandasthumb.org) that anti-dopers were able to catch Floyd Landis by detecting the difference in 13C/12C isotope ratios between the testosterone in his body and the other steroids. Aha, said Paul, that is a sure sign you can detect 'intelligent action' and distinguish it from natural action.

What we won't see is anyone saying that intelligent action -- in this instance, the deliberate use of intelligently-synthesized steroid compounds to gain a competitive advantage -- cannot be detected, in principle, because such inferences involve a universal negative ("natural causes cannot produce x").
Alas, no. Commercially produced testosterone is not synthesized de novo, it's made by making relatively minor modifications in the chemical structure in natural sterols extracted (last time I checked) from yams. So what the antidopers are actually detecting are the geographical and biosynthetic differences in isotope ratios between yams in Africa and Landis's own testosterone, presumably biosynthesized from croissants and that Jack Daniels he claims to have quaffed before the big race.

So the good news is that Nelson has come up with a way to detect the great Intelligent Designer. The bad news is the Intelligent Designer is a root vegetable.

PERMALINK

Stephen Freeping Barr

Stephen Barr, author of Modern Physics and Ancient Faith, the 1699th attmept to reconcile science and religion, is, it turns out, a member of the Free Republic website (as was your fatihful correspondent until about a month ago, when he and the owner had a falling out about the owner's legal liability for libelous attacks posted against RWP on FR by a Christian fundamentalist). Professor Barr was disturbed to find out that there are elements of the creationist movement so far out they claim Galileo was wrong, and the earth is indeed the center of the universe. Dr. Barr tried to explain inertial and non-inertial reference frames to these turkeys, only to find out they don't really accept relativity anyway, and he was forced eventually to resort to argument from authority.

And just in case you think things have changed...

This is an article from the National Catholic Reporter, not exactly a rabid atheist periodical, describing the Little Axe school district case of a quarter century ago in Oklahoma, in which fundamentalists burned the house of a fellow Christian, and mutilated the pet goats of another, for challenging prayer in schools.

Delawarian theocracy

On this July 4, an utterly shocking article on the progress of Christian Dominionism in South Delaware.

In a story that's mostly been under the media radar, two Jewish families have sued the Indian River School District in Delaware, complaining about an almost incredible level of Christian fundamentalism in the public school system. Public prayers by a Christian pastor at the 2004 graduation called for the conversion of the sole Jewish student in the graduating class. Members of Bible clubs, clubs led by district teachers, get to go to the head of the lunch line; special Bible club meetings were held for students who wanted to skip classes on evolution. Teachers evangelized in class, sectarian prayers were held at sports events, and when one set of parents (the Dobriches) complained, their kid was taunted in school as a 'Jew-boy'. The same sixth grader was yelled at to 'take his yarmulke off' when he attempted to speak about it at a school board meeting. Eventually the Dobriches had to move away to escape the harassment. When they filed suit, the school district sought represetnation by the Rutherford Institute, a religious-right advocacy group. The Institute helped the school district draft a new policy on school prayer, which the district refuses to divulge, telling complainants to file a Freedom of Information lawsuit!

Delaware ACLU is suing, and the suit will go to trial in July 2007, assuming the fundamentalists haven't seized power by coup d'etat before then.

Meanwhile, the school district's own insurance company is suing it for rejecting a settlement offer. Maybe they should review what happened in Dover, PA, last year. On the other hand, it sounds like most of the parents in this district thoroughly deserve a nice steep property tax hike.

The Coulter plagiarism snowball is starting to roll...

Plagiarism usually happens when two things converge: an author is trying to write something about which he or she knows very little; and the author is too lazy, busy, or just plain dumb to cover his/her tracks. It's starting to look like Ann Coulter may be one of those authors.

Tracking down plagiarism used to be tedious work. Unfortunately for our modern literary thieves, with computers and the internet it's gotten a whole lot easier. And it appears that Coulter has gotten nailed.

Rude pundit is all over the story. Raw Story is also all over it. The plagiarized sections are starting to pile up, deeper and deeper. Watch out below!

Witless: a review of Ann Coulter's Godless

One of the curious things about book reviewing is that it’s harder to review a bad book than a good one, and Ann Coulter’s Godless is a really bad book. It shows all the signs of having been hastily written, it’s poorly researched, tendentious, and full of falsehoods, half-truths and distortions. In this review, I will focus on Coulter’s treatment of evolution, although her execrable coverage of this subject is matched well by the nonsense she writes about DDT, AIDS, or a variety of other subjects.

No one who knows anything of Coulter would expect anything but a one sided treatment, so accusing her of tendentiousness is almost beside the point. But in approaching a scientific subject, the approach misfires utterly. By making no attempt even to acknowledge the massive scientific evidence for evolution, she leaves one with the distinct impression that the 99% of scientists who embrace the theory are somehow possessed by some form of psychosis. Indeed, if the entire history of evolution were Haeckel’s embryos, the peppered moth, and Piltdown man, as Coulter would have you believe, biology would indeed be in the grip of collective insanity. The scientifically literate person of course knows better, and will dismiss Coulter’s chapters on evolution as nonsense. Alas, judging by the reaction to Godless on the internet, a large fraction of Coulter’s fans are not scientifically literate or indeed literate in any sense. And so, these people, already with a very blinkered view of the world, will now be convinced that scientists are an irrational atheist cult. Wonderful; just what our country needs in the 21st century!

So here is the evidence for evolution, in 500 words or less. The earth was formed 4.7 billion years ago. We know that from measurements of the decay of radioactive long-lived isotopes. Radiometric dating is straightforward, robust, and there is no scientific doubt about it. We can use the same method to date rocks on earth; and we know those rocks are laid down in layers, although the sequence of layers is occasionally disrupted by earthquakes, volcanoes, and other tectonic events. The rocks contain fossils. Many of the fossils are fantastic, extinct creatures – even Coulter readers are familiar with Tyrannosaurus and Triceratops. But a few of them are what we call transitional species. Transitional species have anatomies intermediate between two living groups of animals. The most famous is Archaeopteryx, of which we have eight specimens, most preserved in magnificent detail. Archaeopteryx is almost a perfect intermediate between birds and reptiles; it has feathers and wings; but the wings look like elongated fingers. It has a reptilian tail and a skeleton that lacks many of the special adaptations modern bird have to make flight efficient. It has teeth. Anyone who can look at Archaeopteryx, and still insist there are no transitional species, is lying to himself or others.

But Archaeopteryx is not alone. We have a marvelous series of fossils that fills in the gap between fish and amphibians, ranging all the way from fish with a few amphibian characteristics, to amphibians that look slightly fishy. We have a beautiful series of fossils spanning the evolution of whales, from swamp-living land animals, to swimming beasts with residual hind legs, to the modern leviathan. And we have fossil humans, dozens of them, well spaced out in time, dating back to the era when our ancestor was also the ancestor of chimps, gorilla and orangutans.

Better yet, the modern science of genomics has given us an entirely independent body of evidence from the anatomy of living and extinct animals. It tells us that the human genome is very close to the chimp’s, less close to orang-utan’s, further still from old-world and then new-world monkeys, more distant still from mice and rats and other mammals, thence to reptiles, fish, sea-squirts, etc., etc.. But beyond mere similarity, a detailed analysis of our gene sequences reveals not mere similarity, but that they form a tree, just like a family tree. In the same way a modern American can note in his family tree when his paternal great grandfather came over from Poland (meaning that all later descendants lived in America), so we can date specific changes in our genomic tree, so we find a particular sequence, say, in the all of the species that have common ancestry with us and the old-world monkeys, and not in the new-world monkeys. Were there no fossils, our genes alone would be enough to reconstruct the main features of evolution.

So what does Coulter say about this? Almost nothing. She repeats the creationist canard that transitional species are absent from the fossil record -- a lie. She misrepresents what we know of evolution: she claims that evolutionists believe whales descended from bears that fell in the ocean, another lie. She tells at length the tale of one fraud, Piltdown man, a 'fossil' considered suspect by palaeanthropologists long before it was proven to be fraud, precisely because it didn’t match all of the other human fossils Coulter doesn’t mention. She engages in the despicable practice of quote mining; taking the words of palaeontologist Colin Patterson out of context to make him appear to be an evolution skeptic, which he is not, even though he has publicly and vehemently objected to such practice. She gives a distorted account, apparently culled from a book by moonie creationist Jonathan Wells, of the biology of peppered moths. She falsely accuses Richard Dawkins of misrepresenting a theoretical paper on the evolution of the eye, apparently on the say so of creationist David Berlinski, never mentioning that when Berlinski made the same allegations previously he was comprehensively eviscerated by a host of scientists, including the scientists who did the work. And so on, and so on. As if to make sure even the most famous scientist of the 20th century doesn't escape unscathed from this mire of stupidity, she even gets her account of general relativity exactly backwards.

But most pathetic of all, at the very end of this long, tedious, slapped together collage of creationist canards, Coulter seems to realize what she’s done, and covers her metaphorical ass. Just when a visitor from another planet, or a Baptist in a trailer park, might conclude that all of evolution is a tissue of lies, and that no one but the spawn of Satan or an anencephalic drug-addict (no offense, Rush!) could espouse it, she comes up with this all time champion CYA:

If evolution is true, then God created evolution

But Ann, how could an omnipotent, all-wise deity create the sinister, lunatic, ridiculous process you just wasted 50 pages disparaging? Hilarious!

Don’t waste your money. Don’t waste your time. Feed your brain. Run down to the bookstore, sneer at anyone standing within 10 feet of the Godless display, head over to the science or philosophy section, and buy Daniel Dennett’s wonderful Darwin’s Dangerous Idea. It is to Godless as Albert Einstein was to an amoeba, and I mean an amoeba with a serious genetic defect.

Or as Albert Einstein is to Ann Coulter.

Peas in a pod

I find it disgusting that some people would come here to share their grief at the death of someone else...Many of them, they will cry, be very emotional, but when they pass by me, they stare at me and they don't cry.
--Zacarias Moussaoui, at his trial, on the 9-11 families.

These self-obsessed women seemed genuinely unaware that 9/11 was an attack on our nation and acted as if the terrorist attacks happened only to them. ...But they believed the entire country was required to marinate in their exquisite personal agony.
--Ann Coulter, Godless, p. 102, on the 9-11 widows.

And thanks to Scooby Davis for inspiration.

If you can't answer the question, make it disappear.

Bill Dembski and Pandasthumb are having one of their periodic feuds. In reading Bill Dembski's side of the dispute, I was struck by his use of the term of quantum indeterminacy. So I posted a very simple question on Uncommon Dissent; if |phi> is the wavefunction of the Universe, H is the Hamiltonian of the universe, and the universe evolves according to the Schrödinger equation, where is the indeterminacy? My question has vanished. But he does include this little snippet.

True, there is a sense in which quantum mechanics is deterministic: The evolution of the state function by means of the Schroedinger equation is deterministic; that is, given the state function at a given time, the Schroedinger equation prescribes the exact state at some future time. Nonetheless, the state function itself characterizes a probability distribution, and all observation of quantum systems involves sampling from such probability distributions.

Well, no. The state function doesn't characterize a probability distribution. Probability distributions are obtained from state functions, not vice versa. And if the wavefunction is that of the whole universe, there is no external observer, and no indeterminacy. In fact, indeterminacy in QM is a consequence of the artificial process of separating the universe into system and observer, and of the observer having incomplete information. Quantum systems are in practice indeterminate; but in principle, as far as QM is concerned, the universe is deterministic.

It's a simple idea. I wonder why Dembski is afraid of it? Oh, here's why...

Let us now return to the question of how an unembodied designer can impart information into the natural world without imparting any energy. Setting aside the many-worlds interpretation of quantum mechanics and the determinism it implies, let us grant that there is genuine indeterminism in the natural world. In that case, whether an unembodied designer works through quantum mechanical effects is not ultimately the issue. Certainly quantum mechanics is more hospitable to an information processing view of the universe than the older mechanical models. All that is needed, however, is a universe whose constitution and dynamics are not reducible to deterministic natural laws (indeed, given the imprecision inherent in our measurements, there is no way ever to establish determinism with finality)

QM doesn't provide such a universe. Sorry, Bill.

Our tax dollars at work.

...and this time I have no complaints. Nice job, F-16s. Go buy yourself a couple dozen more of those neat little 500 pound bombs.

Coulter lie of the day

Well, thanks to my co-conspirators at Darwin Central, the conspiracy that cares, I just got through the 'science' chapters of Ann Coulter's Godless. And yes, they are truly awful. It's like being strapped to chair and listening to a very loud, stupid, shrill lunatic berate you for hours on end.

There are people who claim Coulter's writing is humorous. Unintentionally, maybe. But it's really just a staccato series of exaggerated, distorted, or just plain false claims, followed by insults usually couched in the form of a completely obvious joke. She writes in the general style of a world-weary ten year old. I'm not the first to note that you finish an Ann Coulter book feeling both stupider and vaguely annoyed at having wasted your time.

Anyway, I had promised to simply list all the falsehoods and distortions in the book, but this is simply not going to be possible in a day, a week, or even a month. The entire book is crap, and how much time can one spend discussing crap? So what I'm going to do is take one lie a day from Coulter, explain why it's a lie, for as long as it takes, or until I'm 65, whichever comes soonest. Here we go: page 191.

Continuing its tradition of helping the poor and enslaved, in 1986 the State Department Informed African nations that the United Slates would no longer provide aid to countries using DDT.
I can find no record of such a policy. A 1986 telegram from George Schultz, Ronald Reagan’s secretary of state (and no liberal!), to US embassies, instructed them to inform African governments that the US would not participate in programs using DDT, not that the US would cut off aid. Swaziland, for example, has never discontinued the use of DDT, and the US has continued to provide aid at the same level throughout the 1980s and 1990s. In fact USAID does support indoor spraying with DDT, albeit not as the most favored alternative. While most environmentalist organizations were leery of use of DDT for mosquito control - because, historically, such DDT has been diverted for agricultural use, and agricultural use actually speeds the evolution of DDT-resistant mosquito, harming the fight against malaria - in general now they do not oppose indoor spraying.

Coulter also claims that the United States and Europe, at the behest of environmentalists, have threatened to ban Ugandan exports if it uses DDT to stop malaria. That isn't true either. The US has never made such a threat. The EU merely said that if spraying led to crop contamination, that particular crop consignment could not be sent to Europe. In fact, much of the pressure on the EU to tighten anti-DDT practices came not from environmentalists, but from its own agricultural producers and the chemical company Bayer, which manufactures competitive insecticides.

Ann Coulter hates America


eagle picture
Chapter 1 of the ditz's latest ravings is now online at townhall.com. I was struck by this passage.
Our book is Genesis. Their book is Rachel Carson’s Silent Spring, the original environmental hoax. Carson brainwashed an entire generation into imagining a world without birds, killed by DDT. Because of liberals’ druidical religious beliefs, they won’t allow us to save Africans dying in droves of malaria with DDT because DDT might hurt the birds. A few years after oil drilling began in Prudhoe Bay, Alaska, a saboteur set off an explosion blowing a hole in the pipeline and releasing an estimated 550,000 gallons of oil. It was one of the most devastating environmental disasters in recent history. Six weeks later, all the birds were back. Birds are like rats—you couldn’t get rid of them if you tried.

Carson just wrote a book. She didn't brainwash anyone. It was a rather hysterical book, just like all of Coulter's. Carson was wrong about DDT and cancer. But Carson did get some things right, and one thing she got right was the effect of DDT and other chlorinated hydrocarbons on birds, particularly raptors. This really isn't a matter of scientific controversy. As Paul Johnsgard, a colleague of mine and the dean of American ornithology, wrote in his definitive Hawks, Eagles and Falcons of North America...

this phenomenon of reduced reproductive capacity in predators largely has to do with the biological magnification of toxic substances in predatory species representing the end of ecological food chains

The toxic substances are of course, DDT and the other chlorinated pesticides extensively used in the US through about 1970. Raptors reached their nadir in 1972. And one of the most seriously affected raptors was our national symbol, the bald eagle, which DDT reduced to a few hundred pairs in the lower 48. This is one of the birds that Coulter is comparing to a rat (later on she calls it vermin). Quoting Johnsgard again...

Like other raptors, bald eagles began a slow recovery following the banning of DDT in 1972, which was supplemented by the later bannings of the pesticides dieldrin (1974) and endrin (1984).

Other raptors were also almost wiped out by DDT, and have recovered since 1972. One is the peregrine falcon. Anyone who has seen a peregrine kill a pigeon in a full stoop will never forget it; it makes an F-16 look like a school bus. It's truly one of the most magnificent and beautiful things in nature. Why would a supposedly religious person dismiss as 'vermin' one of the true jewels of creation?

The biggest international problem with the use of DDT for malaria prevention is mosquito resistance. In India, the fight against malaria was lost in the 1960s, well before the environmental movement had any impact, when a combination of government ineptitude and the evolution of resistant strains of Anopheles stymied what had hitherto been a very effective fight against the disease. DDT resistance has already appeared in South African mosquitos. Of course, Coulter doesn't believe in evolution, so she isn't aware of DDT resistant Anopheles.


Talk about being a victim of your own mythology.

Ditz on ditz

RWP hasn't had a chance to shred Ann Coulter's Godless yet. But a co-conspirator from Darwin Central did point him to the first review in print, from one Lisa de Pasquale, in Human Events online. Human Events, once a distinguished conservative weekly, actually turned to a Public Relations/Journalism B.A. from Flagler College, FL to critique Political Science major Coulter's ravings on the central paradigm of biological science. This is somewhat like having Stevie Wonder critique a Helen Keller column about Monet's use of color. RWP doubts if the two ladies (term used loosely), working in tandem, could pass a high-school math proficiency test.

Of course, complete ignorance of a subject has never inhibted Coulter from writing about it.

The review has little to say about biology. A few tired reminders that Inherit the Wind wasn't a documentary (no kidding!), the usual stupid Coulter one liners, this time comparing evolution to scientology, a brief nazi smear, and she's done.

De Pasquale has a history of effusive reviews of women writers. She's given adulation in the past, to Schlafly and Kate O Beirne, though Coulter seems to be her current favorite. Oddly enough she also seems to be a bit of a homophobe. Hmmmm.....

RWP weeps for the demise of Human Events, a once proud conservative magazine, which like so much of the right seems to have turned to anti-intellectualism and bomb throwing.

Ten reasons not to vote for Tom Osborne

Dirty campaigning Ol' Saint Thomas just got caught doing a push poll, and as usual, when caught doing something sleazy, he attempted to evade responsibility for it. And his 'apology' for the incident was a total cop-out. "I apologize if you were offended" isn't an apology, Dr. Tom. You don't have any responsibility for my taking offense, only for your own actions. A conservative would understand that.

John McCain's endorsement Just on its own, endorsement by the mainstream media's favorite faux-Republican is enough to cost you my vote. McCain has campaigned against pretty much every conservative cause and issue over the last 10 years. And what does it say about a man that his two most prominent legislative efforts (McCain-Feingold and McCain-Kennedy) were co-sponsored with left-wing Democrats?

Lawrence Phillips was a brutal thug. The fact he dragged his girlfriend down several flights of stairs by her hair was a big clue. He was also a great running back. Saint Tom knew he needed Phillips to win the National Championship, so he continued to play Phillips despite his thuggery, all the time bleating about 'redemption'. Win-at-all-costs coaches are nothing remarkable, but it takes special chutzpah to be a win-at-all-costs coach who preaches sanctimoniously about altering young men's lives for the better. Or does anyone think that Osborne really believed that the prayer sessions he led were going to turn the couple of rapists and thugs on his squad into upstanding citizens?

Pro-illegal immigration Osborne has consistently promoted programs to reward illegal immigrants and thence attract more to the US. And then he has the nerve to claim Heineman, who has been the strongest of the three gubernatorial candidates against immigration, doesn't have a position on it!

Campaign finance 'reform' Osborne was one of the few House Republicans to vote for this gross abridgment of free-speech rights. Tom wants you to hear him, and the newspapers who endorse him, but not positions opposed to his.

Disloyalty Heineman has been a good, competent, conservative Republican governor. There is no justification for running a primary campaign against him. But it's all about Osborne. He's tired of flying back and forward to Washington to do the job he was elected to do.

Democrats. Because Osborne knows Republicans like him less the more they find out what he's been up to, his campaign has been actively trying to recruit Democrats to change their registration and vote for him in the Republican primary.

The Lincoln-Journal-Star, Lincoln's disingenuously left-wing newspaper, endorsed him

Frank Solich. So much for being able to pick competent staff!

and the final reason not to vote for Tom Osborne is.....

He's a football coach, for heaven's sake! Can't we at least find a competent shop teacher?

My Month without Mexico

I am a former legal immigrant to this country. As one who obeyed this country's immigration laws up to the point I was awarded citizenship, the current fervor to grant citizenship to those who have flouted the laws of this country fills me with disgust. And today's anti-American 'boycott' is the last straw.

Accordingly, today I begin my boycott. For the next month I will buy nothing made in Mexico, or associated in any way with that country. If you want RWP to shun your product, put a Mexican flag on it. If you want me to avoid your restaurant, put a rack of pro-illegal-immigrant newspapers in the lobby. I will also be boycotting all packaged meat and chicken from illegal-alien-employing companies like Cargill, Perdue, and Tyson (I need to lose some weight, anyway). Since my annual income is at least 5 times that of the average illegal alien, and since I'm doing this for a month, not just a day, figuring out the relative impact ought to be easy.

Dembski gets it wrong again

It always shocks me when apparently intelligent people get their facts wrong for want of a couple of minutes of checking.

Salvador Cordova (OK, I admit 'intelligent people' in this instance is a bit of a stretch) writes a paean on Dembski's blog today to creationist John Sanford and his recent book 'Genetic Entropy: The Mystery of the Genome.'. As a physical chemist, the title alone makes me nauseous, but let's get right to Cordova's claims

Cornell is considered by some to be among the top 12 universities in the world, and Cornell has an IDist in their biology department! John Sanford is a very successful professor of biology at Cornell and is inventor of the Gene Gun

Well, no. Sanford was in the Cornell Agriculture School, as a Associate Professor of Horticulture. He never was fully promoted, and he was never in biology. He does still have a courtesy appointment in horticulture, and he does have some significant patents in biotechnology.

From what little I've read of his book, it appears to be nonsense.

No science please, we're Arkansans

Alan Cerveny, Dean of Admissions,
University of Nebraska at Lincoln

March 26, 2006

Dear Dean Cerveny:

Please read the linked article from the Arkansas Times, which details how the high-school science content in Arkansas has been stripped not only of any mention of evolution, but anything that contravenes a young-earth creationist viewpoint, including any mention of the age of the earth or of the universe. After reading it, I had to question whether high-school science credits from that state should be used to satisfy high-school science requirements at UNL. While I appreciate we are under pressure to increased enrollments, and don’t want to discourage out-of-state students from coming here; while I appreciate we can’t police the content of every high-school course, and have to rely on state educational authorities to appropriately accredit schools and course content; and, while, having taught courses at the Freshman level in chemistry and biological chemistry at UNL, I am under no illusions that Nebraska high schools teach the sciences to a uniformly high standard. I think our admissions department, perhaps in conjunction with the College of Arts and Sciences, needs to take a serious look at high-school science courses in states like Arkansas, Kansas, and perhaps others, where there have been successful efforts to dumb down the curriculum so it doesn’t offend fundamentalists. I urge you to begin such efforts.

The left rediscovers plagiarism

Leftist bloggers, bless their tiny hearts, have finally gotten a juicy scoop to sink their fangs into. Ben Domenech, a conservative blogger who seems to have been elevated far beyond his abilities by the Washington Post, has been exposed as a plagiarist. Atrios and Daily Kos have compiled lots of nuggets of stolen material.

RWP hadn't knowingly read anything Domenech had written until this brouhaha; and having now read some, he is shocked not so much by the plagiarism, but by the fact the WaPo employed such an untalented, uninspired writer as house right-wing blogger. Domenech's stuff (or the parts of it that are original) seem to be uninsightful and uninformed rants in the same genre as literally thousands of internet bloggers. He is, as Phayngula notes, a creationist; and his ignorance of biology is matched by ignorance of pretty much everything else.

Domenech's whiny apologia, in which he blames others, makes excuses, and generally plays the self-pitying drama queen, is just plain embarrassing to read. Obviously preaching to others about personal responsibility is a whole 'nother thing from taking some yourself. His demise is a small loss to us all. In fact, maybe the WaPo can replace him with a conservative who actually has something original or interesting to say.

RWP is amused, however, by the left's rediscovery of the noxiousness of plagiarism, a mere two months after our annual, leftist-invented celebration of the life of a man whose plagiarism was far more egregious than Domenech's. Martin Luther King plagiarized, not a few blogs, but an entire doctoral thesis, and on ethics, fewgawdsake! Yet, in all of the annual sanctimonious maunderings about King, how often is his plagiarism even acknowledged?

RWP has a dream that one day, Domenech, and King, and Joe Biden, and Doris Stearns Goodwin, and Stephen Ambrose will all be consigned to some common circle of hell, where they will be unable to speak except in the words of others. And lest he be accused of plagiarism, the 'I have a dream' speech. or at least the tail end of it, was given by the Reverend Archibald Carey at the 1952 Republican National Convention. Credit where credit is due.


Domenech has now apologized for his apology. This is getting Pythonesque!

Non, je ne regrette rien...

Now I know why I don't get invited to parties

According to the University of Minnesota, a forthcoming paper in American Sociological Review reveals that our fellow Americans regard atheists as least likely to share their vision of American society, and are the people they'd least like their daughters to marry.


Many of the study’s respondents associated atheism with an array of moral indiscretions ranging from criminal behavior to rampant materialism and cultural elitism.

The irony is that atheists have a lower incidence of criminality than almost all religious groups, are less likely to get divorced, and score higher on most measures of ethical behavior. But the study shows what many of us suspected; that religious Americans are as often as not ignorant and intolerant bubbas. After all, if can swallow the notion of a hypothetical celestial scorekeeper and jailer, who expects you to crowd into a garish building once a week with a bunch of credulous bubbas, clad in their best polyester, dragged there by their big-haired wives, and listen to shallow platitudes about hypothetical beings, mouthed by rednecks with thick Southern accents, who knows what other garbage you believe?

Come to think of it, maybe the cultural elitist charge is fair :-)

Wieseltier on Dennett

Leon Wieseltier's hack review of Dennett's Breaking the Spell (which RWP is about half way through) has been ably rebutted on Pharyngula and Leiter Reports. I have just a couple of other comments.

First, Wieseltier's animus against the theory of evolution was manifest in his selection of Gertrude Himmelfarb to review two books on Darwin for New Republic. Himmelfarb wrote a biography of Darwin which was distinguished principally by its scientific ignorance; and her review in TNR was no better. Clearly Wieseltier thinks so little of science he considers it OK to have scientific know-nothings review scientific books. Given that, it's hardly surprising he would be antagonistic towards Dennett, who is perhaps the most pro-science of all modern philosophers

Second, I wonder is all of this the despair of the humanist who sees the domain of his own field gradually eroding away? As biology explains more and more of what philosophers have hitherto regarded as their own sphere of interest, some philosophers become more and more resentful of biology. If religion can be explained as the by-product of evolutionarily selected intrinsic human traits, what becomes of the philosophy of religion? One can sympathize a little with Wieseltier, but surely an intelligent man should be able to see in himself the ghost of Ned Ludd?

Funerals, political rallies, what's the diff?

Yesterday the nation buried Coretta Scott King, a woman who spent the last quarter century fighting for the right, as the Economist put it, to give rich African-American children racial preferences over the children of poor Vietnamese refugees. This is what passes for civil rights in contemporary America.

Meanwhile, Democrats and 'Civil-Rights leaders' showed that neither has a clue how to behave, as they once again turned what was supposed to be a dignified funeral into a political rally. Most contempable of all, as usual, was Jimmuh Carter, the worst president of the twentieth century and a one-man refutation of the myth of 'southern courtesy', who conflated J Edgar Hoover's bugging of King with the NSA's international wiretap program.

Gosh, I hope this doesn't insult any Muslims!

In solidarity with Jyllands Posten.

...of all the dumb things religious conservatives have said about evolution

...this has to be one of the dumbest, from David Klinghoffer in the Seattle Post-Intellligencer.

Whatever its merits as science, Darwinism as a philosophy is far from uplifting or ennobling. Today when young Americans could use a little uplift and an appreciation for what's noble, letting them know about intelligent design, an alternative scientific theory with none of Darwin's drawbacks, couldn't hurt and might help.

So we should teach them unscientific ideas in the guise of science in order to 'uplift' them? Well, why pick on evolution? Let's teach them, contrary to relativity, that there is a fixed and unique frame of reference for the universe! Let's teach them that if we build a really, really good spaceship, we can travel faster than light! Let's teach them that contrary to the second law of thermodynamics, order can spontaneously arise out of disorder in a closed system!

And why stop at science? There was scarcely anything more ignoble than the Holocaust. It's just horrible, and not at all uplifting, that man did that to his fellow man. Let's teach them it was perpetrated by space aliens!

Best of all, let's teach them that because some guy was killed 2000 years ago, none of the bad stuff they do counts against them. (Oh wait, we do teach many of them that. Never mind!)

Fame and fortune

Nine years ago, UNL made Martin luther King's birthday an academic holiday. It's been a major pain in the ass ever since; the last thing you need, in scheduling classes, etc., is a dead Monday in the second week of the semester. At the time, I opposed the holiday, and created a web page dedicated to Martin Luther King's plagiarism; I also wrote a column in the Daily Nebraskan. I'd forgotten about the web page until today, when I got an email from one of Michael Savage's listeners, who said that Savage had mentioned my column on line, but that the link was dead. In fact, almost all the links on my page are dead, but in the interests of history, I'll resurrect them.

In the meantime, here is my column on Martin Luther King's plagiarized Ph.D. thesis. Enjoy!

Fundy fibber of the week

A new feature on the blog! Yes, your devoted correspondent will search the print media and the web for egregious fundy fibs about evolution, athesim, or the other numerous things about which fundies lie through their decayed teeth.

This week's fundie fibber is Linda Kimball, a self-described 'conservative activist' from Prince George, Virginia, who in an outstandingly rabid rant on the ChronWatch web site, uses a bogus Patrick Henry quote that even the original instigator, David Barton, disavowed.

Barton, in his The Myth of Separation, collected a number of quotations from the Founding Fathers that turned out to be unsourced or even downright false. After several such quotes were revealed to be bogus, Barton recommended they not be used, although he tendentiously argued there was no reason to believe they were false. Notwithstanding Barton's admission, however, several of the 'quotes' have spread like the plague around the net. One such quote is alleged to have been uttered by Patrick Henry, although it appears nowhere in his papers.

It cannot be emphasized too strongly or too often that this great nation was founded, not by religionists but by Christians; not on religions, but on the Gospel of Jesus Christ. For this very reason peoples of other faiths have been afforded asylum, prosperity, and freedom here.
Amusingly, Kimball even gets the bogus date wrong, giving it as 1775 instead of the usual 1765 (maybe she realized that Henry referring to 'this great nation', 11 years before the declaration of independence, was a bit anachronistic). Ed Brayton, a few months ago, noted that this quote is not just unsourced but implausible.

Anyway, in accordance with what will be the policy of our Fundy Fibber series, I gave Kimball the chance to correct her mistake, even providing her with the Barton link. She replied with an ad hominem, and thus becomes our inaugural Fundy Fibber.

Kimball says she got the quotation from a compilation by radio talk-show host Chuck Baldwin. RWP has sent Baldwin the Barton Unconfirmed Quotes link; stay tuned to find out if Baldwin also earns a place among the Fundy Fibbers!

I don't want to waste time dismembering the other drooling idiocies in Kimball's rant, although another FReeper has noted that the 'Russian Manual of Psychopolitics', which Kimball also quotes, is a forgery, possibly created by the Church of Scientology. Cultist politics makes strange bedfellows.

Another one bites the dust

William A. Dembski's Uncommon Dissent blog, from which RWP was banned after posting some embarrassing details of a creationist conference in Prague, has been shut down by its author. Dembski never really had the blog thang down anyway; his purging of the slightest dissent made the blog merely an ego-trip for him, fueled by his scientifically illiterate acolytes. Not that Dembski knows much science either.

Another sign of the sagging fortunes of creationism's latest Trojan Horse? Maybe. But certainly an improvement of the average intelligence level of the blogosphere.

What I did on my winter vacation...

While I have a soft spot for anhingas and snail kites, the roseate spoonbill is my favorite endemic Florida bird. There were dozens of roseate spoonbills at Merritt Island NWR a few days ago. IIRC, this is unusual; historically, they winter in South Florida. More evidence of climate change? Our real-estate broker, an avid gardener, assures me the last freeze on the Space Coast was 1989.